shannonnnn3593 shannonnnn3593
  • 01-09-2017
  • Biology
contestada

Which of the choices below are true statements about the hyoid bone?

Respuesta :

Erythrosin17
Erythrosin17 Erythrosin17
  • 12-09-2017
The hyoid bone is the attachment site for some tongue muscles. It is also called the tongue bone or the lingual bone. It functions as an anchoring structure of the tongue. It is located at the end part of the tongue, front of the neck. 
Answer Link

Otras preguntas

Guys pls help me!!!!!!!
Can I use a 3 sentences example for the words revolution, hierarchy, nationalism, civilize and exploit?
PLZ HELP MY MIND IS DYING
The gravitational force between a satellite and Earth’s moon is 324 N. The mass of the moon is 7.3 × 1022 kg. If the distance from the moon to the satellite is
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
find the constant rate of change.
3x=14-2y solving for y
Evaluate the expression. 9.(13)
Someone pls help pls
How is writing an equation to represent a situation involving two variables similar to writing an equation to represent a situation involving only one variable?