keirnsey keirnsey

04-05-2017
History

contestada

how did the constitution fix the articles of confederation

Respuesta :

cookieda cookieda

04-05-2017

An executive branch was added and states did not have too much power like they did under the Articles of Confederation. There's more but these are the most basic ones I know lol.

Answer Link

Otras preguntas

The sterile material that is placed directly on a wound is termed the:

A hat contains three ping-pong balls numbered 1, 2, and 3. kim draws one from the hat. then, without replacing the first ball, she draws another. what is the sa

What was the main idea of Rousseau's famous work "The Social Contract".

who invented the glass harmonica

all other things being equal,the size of a population will decrease if

Suppose the heights of 18-year-old men are approximately normally distributed, with mean 67 inches and standard deviation 5 inches. (a) what is the probability

Virginia is 7-years old. georgia is 14 years old. both girls like to write short stories

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Who was the u.s. general fired during the korean war for trying to create another world war with china?

For hundreds of years before India’s independence from Great Britain, Hindus and Muslims had been A.independent B.peaceful C.separate D.hostile