babyyxsam babyyxsam
  • 03-02-2017
  • Advanced Placement (AP)
contestada

if you had the opportunity to live on another planet, but you wouldn't be able to get back to earth for 10 years, would you do it? why or why not?

Respuesta :

lexirene
lexirene lexirene
  • 03-02-2017
Yes because i would get to be in space and see another planet  and i  would like to see what its like i bet it would be cool and a great adventure.
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the range of function of y-1=(x+3)^2
I want to work with LDAP. what is LDAP?
Which word has the long i sound? relieve speciality society social
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
what is 0.00001267 is scientific notation
What kind of problems did increased urbanization cause? During time of industrial revolution
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
a summary about concussions