prettybabeyy1089
prettybabeyy1089 prettybabeyy1089
  • 04-03-2022
  • Spanish
contestada

Match the Spanish indirect object pronouns in the first column with their English equivalents in the second column me,you,

Match the Spanish indirect object pronouns in the first column with their English equivalents in the second column meyou class=

Respuesta :

francoangulo14
francoangulo14 francoangulo14
  • 04-03-2022

Answer:

nos- us

me- me

te- you

le- him/ her

Explanation:

I'm Spanish speaker

Answer Link

Otras preguntas

Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?
Graph the six terms of a finite series where a1 = -3 and r = 1.5.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Angie takes a random sample of 100 students in her school and finds that 58% of the sample prefers art over music. There are 1,200 students in the school. Based
What does hemostasis mean?
Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
How much money, in dollars, does one mole of nickels represent?
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.