digie79 digie79
  • 04-01-2017
  • Mathematics
contestada

convert 12.5 pounds to ounces

Respuesta :

Аноним Аноним
  • 04-01-2017
Well there are 16 ounces in one pound so multiply 12.5 by 16. 
12.5 • 16 = 200

There are 200 ounces in 12.5 pounds. Plz! I need brainliest. Could you help out if someone else answers too?
Answer Link
addyH04
addyH04 addyH04
  • 05-01-2017
200 ounces hope it helps
Answer Link

Otras preguntas

There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what is the most common type of vegetation throughout Latin America
Round 46.895 to the nearest tenth
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
does a human body use neon???
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
In which sentence does the prepositional phrase act as an adverb? A. Last evening, Anne suffered from a headache. B. The door to the attic was left open. C. Mr
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3