Seudónimo Seudónimo
  • 04-02-2021
  • Computers and Technology
contestada

When a new component is able to support a legacy component this is called?

A) Open platform

B) Plug and play

C) Backward compatibility

D) Rip Vanwinkle theory

When a new component is able to support a legacy component this is called A Open platform B Plug and play C Backward compatibility D Rip Vanwinkle theory class=

Respuesta :

lay1a
lay1a lay1a
  • 05-02-2021
A) Open platform and C) Blackwsfd compatibility
Answer Link

Otras preguntas

A light bulb converts electrical energy into electromagnetic energy is true or false?
testosterone directly affects the
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right
What is the additive inverse of -4a
Help pl0x, Algebra 1
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for