chantellejames4073
chantellejames4073 chantellejames4073
  • 02-05-2020
  • English
contestada

Help me please. Help.

Help me please Help class=

Respuesta :

mmitchedll47
mmitchedll47 mmitchedll47
  • 03-05-2020

Answer:

the answer is A

Explanation:

im pretty sure

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Cell respiration why does a runner breathe hard after finishing a race
Which event in the typical life cycle of sexually reproducing fungi involves transition from a haploid to a diploid stage?
Which of the following are solutions to the equation below? Check all that apply. x2 - 16 = 0
How many 1900 galveston hurricane facts homes and buildings was destroyed?
why is derek miller's social media post different than most?
When you prepare to make a left turn from a one-way road into a two-way road, you must:?
A rectangular garden is 9 feet long and 3 feet wide. A second rectangular garden has dimensions that are triple the dimensions of the first garden. What is the
According to engels, what purpose did government serve? a. to organize production c. to create new jobs b. to revolt against workers d. to pass laws ending oppr
plz help 10 pts A temporary magneta easily loses its magnetism.b has two north poles.c keeps its magnetism for a long time.d cannot be destroyed.