bobrossrules
bobrossrules bobrossrules
  • 03-04-2020
  • Mathematics
contestada

12a-4(5a-1) = 2(3a +6)-4a

Respuesta :

monsemonroy monsemonroy
  • 03-04-2020

Answer:

The answet to the following question is a = -5/4.

You distribute and then combine similar terms.

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Which statement is true about nonfiction? Question 1 options: Nonfiction can contain facts, opinions, and ideas. Nonfiction deals with imaginary people and made
Find the length of the missing side of a right triangle if a=6 and c=11
Select all that apply: according to fisher, the effects of globalization on indigenous peoples include___________.
what is the sum of odd positive integers less than 50
(8n+1)(6n-3) please solve in quadratic formula
Analysis questions for b.what changes occurred in both forms of the moth over these ten years?
Let f(x) = x+7 and g(x) = x-4 Find f(x) times g(x)
Find the equation, in point-slope form, of the line that passes -3 and passes through the point (1,2). plz show your work.
A hat contains three ping-pong balls numbered 1, 2, and 3. kim draws one from the hat. then, without replacing the first ball, she draws another. what is the sa