23ernestof05 23ernestof05
  • 01-04-2020
  • Mathematics
contestada

How can I solve this?

How can I solve this class=

Respuesta :

SaltySpark
SaltySpark SaltySpark
  • 01-04-2020

Answer:

x>6 or <=4

Step-by-step explanation:

Look at the number line. Open circle means the number isn't included in the domain.

Answer Link

Otras preguntas

Which of the following is the modern counterpart of the journal and diary? a. A magazine article b. A blog c. A speech d. A newspaper article
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
does a human body use neon???
Please answer theses division problems!! 9 divided by 3/7
What would be the most likely effect of one company buying a competitor?
The process of chemical cycling is known as a biogeochemical cycle because it A. takes places over a long period of time B. withdraws the
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
an explanation describe if an orange pet mates with another orange pet, can they have any green offspring.
all 231 students in the math club went on a field trip. some students rode in vans ehich hold 7 students each and some students rode in buses which hold 25 stud