melanie5015 melanie5015
  • 02-10-2019
  • Biology
contestada

what are the sources of CO2 pollution?

Respuesta :

emwl emwl
  • 03-10-2019

There are both natural and human sources of carbon dioxide emissions. Natural sources include decomposition, ocean release and respiration. Human sources come from activities like cement production, deforestation as well as the burning of fossil fuels like coal, oil and natural gas.

Answer Link

Otras preguntas

What would be the most likely effect of one company buying a competitor?
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
what is 0.00001267 is scientific notation
4(3-5)=-2(8-z)-6z what is z
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Is 5/7 greater than 4/6
Please help with Algebra 1
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
CAN ANYONE PLEASE HELP WITH MATH? The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the n
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before