sosick6228 sosick6228
  • 01-07-2019
  • Mathematics
contestada

Select all the levels of measurement for which data can be qualitative.A.Nominal.B.IntervalC.RatioD.Ordinal

Respuesta :

S28061646
S28061646 S28061646
  • 01-07-2019

Select all the levels of measurement for which data can be qualitative.A.Nominal.B.IntervalC.RatioD.Ordinal

ratio

Answer Link

Otras preguntas

Read each verbal expression Then assign a variable and distribute
A teratogen is any agent or condition that increases the risk for: select one: a. prenatal abnormalities. b. damage to the placenta. c. extra chromosomes. d. ma
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Simplify the expression: (5a^4b^2)^3(-2b^4)
Who basically "began" England's religious reformation?
Toco el piano _______________ hace dos meses. desde se les por
Under the articles of confederation, political power and authority ultimately rested with the ________.
a jar contains 6 jellybeans, 4 green jellybeans, and 4 blue jelly beans. if we choose a jellybean, then another without putting the first one back in the jar, w
What is the slope of the line that contains the points (10,-3) and (8,-9)?
The striton family had a meal catered for a wedding rehearsal dinner. The cost of the dinner was $476. There was a 5% sales tax and they left a 15% tip. What wa