haroldk haroldk
  • 04-06-2018
  • Mathematics
contestada

Place the indicated product in the proper location on the grid.
-2x^2y^3 · 14x^2y^3

Respuesta :

carlosego
carlosego carlosego
  • 04-06-2018
We have the following product:
 -2x ^ 2y ^ 3 · 14x ^ 2y ^ 3
 For power properties we have:
 "same base add the exponents"
 We have then:
 (-2 * 14) (x ^ (2 + 2)) (y ^ (3 + 3))
 -28x ^ 4y ^ 6
 Answer:
 
The product -2x ^ 2y ^ 3 · 14x ^ 2y ^ 3 is:
 
-28x ^ 4y ^ 6
Answer Link

Otras preguntas

Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
How do you put allele in a sentence
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Divide the polynomial in the numerator by the trinomial in the denominator m^3-m^2-4m+1 /m^2+2m-3
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
31+34=90-n 45+1=70-k 6×9=41+m
The Panama Canal connects what two bodies of water?